T3DB: Metallothionein-3

Name	Metallothionein-3
Synonyms	GIF GIFB Growth inhibitory factor Metallothionein-III MT-3 MT-III
Gene Name	MT3
Organism	Human
Amino acid sequence	>lcl\|BSEQ0017834\|Metallothionein-3 MDPETCPCPSGGSCTCADSCKCEGCKCTSCKKSCCSCCPAECEKCAKDCVCKGGEAAEAE AEKCSCCQ
Number of residues	68
Molecular Weight	6926.855
Theoretical pI	Not Available
GO Classification	Functions cysteine-type endopeptidase inhibitor activity involved in apoptotic process drug binding zinc ion binding copper ion binding antioxidant activity cadmium ion binding protein kinase activator activity Processes cellular response to oxidative stress cadmium ion homeostasis negative regulation of neuron apoptotic process positive regulation of protein phosphorylation negative regulation of oxidoreductase activity cellular metal ion homeostasis positive regulation of transcription, DNA-templated regulation of response to food negative regulation of cysteine-type endopeptidase activity positive regulation of vascular endothelial growth factor receptor signaling pathway negative regulation of apoptotic process cellular response to cadmium ion negative regulation of hydrogen peroxide catabolic process negative regulation of cysteine-type endopeptidase activity involved in apoptotic process negative regulation of axon extension negative regulation of necrotic cell death negative regulation of transcription, DNA-templated response to hypoxia cholesterol catabolic process positive regulation of lysosomal membrane permeability energy reserve metabolic process cellular zinc ion homeostasis positive regulation of oxygen metabolic process negative regulation of cell growth positive regulation of transcription from RNA polymerase II promoter in response to oxidative stress protein kinase B signaling regulation of protein glycosylation activation of protein kinase B activity protein import into nucleus, translocation histone modification zinc II ion transport removal of superoxide radicals cellular response to nitric oxide astrocyte development brain development zinc ion homeostasis ERK1 and ERK2 cascade cellular lipid catabolic process positive regulation of ERK1 and ERK2 cascade negative regulation of autophagy negative regulation of reactive oxygen species metabolic process cellular response to hypoxia cell proliferation positive regulation of catalytic activity positive regulation of necrotic cell death positive regulation of cell death protein stabilization cellular response to drug leptin-mediated signaling pathway positive regulation of gene expression Components dendritic spine intracellular cytoplasm axon rough endoplasmic reticulum ribosome postsynaptic density microtubule plasma membrane extracellular space synaptic vesicle mitochondrial outer membrane inclusion body perinuclear region of cytoplasm astrocyte end-foot
General Function	Zinc ion binding
Specific Function	Binds heavy metals. Contains three zinc and three copper atoms per polypeptide chain and only a negligible amount of cadmium. Inhibits survival and neurite formation of cortical neurons in vitro.
Pfam Domain Function	Metallothio (PF00131 )
Transmembrane Regions	Not Available
GenBank Protein ID	Not Available
UniProtKB ID	P25713
UniProtKB Entry Name	MT3_HUMAN
Cellular Location	Not Available
Gene sequence	>lcl\|BSEQ0017835\|Metallothionein-3 (MT3) ATGGACCCTGAGACCTGCCCCTGCCCTTCTGGTGGCTCCTGCACCTGCGCGGACTCCTGC AAGTGCGAGGGATGCAAATGCACCTCCTGCAAGAAGAGCTGCTGCTCCTGCTGCCCTGCG GAGTGTGAGAAGTGTGCCAAGGACTGTGTGTGCAAAGGCGGAGAGGCAGCTGAGGCAGAA GCAGAGAAGTGCAGCTGCTGCCAGTGA
GenBank Gene ID	Not Available
GeneCard ID	Not Available
GenAtlas ID	Not Available
HGNC ID	HGNC:7408
Chromosome Location	16
Locus	Not Available
References	Uchida Y, Takio K, Titani K, Ihara Y, Tomonaga M: The growth inhibitory factor that is deficient in the Alzheimer's disease brain is a 68 amino acid metallothionein-like protein. Neuron. 1991 Aug;7(2):337-47. 1873033 Palmiter RD, Findley SD, Whitmore TE, Durnam DM: MT-III, a brain-specific member of the metallothionein gene family. Proc Natl Acad Sci U S A. 1992 Jul 15;89(14):6333-7. 1631128 Tsuji S, Kobayashi H, Uchida Y, Ihara Y, Miyatake T: Molecular cloning of human growth inhibitory factor cDNA and its down-regulation in Alzheimer's disease. EMBO J. 1992 Dec;11(13):4843-50. 1464312 Naruse S, Igarashi S, Furuya T, Kobayashi H, Miyatake T, Tsuji S: Structures of the human and mouse growth inhibitory factor-encoding genes. Gene. 1994 Jul 8;144(2):283-7. 8039715 Amoureux MC, Wurch T, Pauwels PJ: Modulation of metallothionein-III mRNA content and growth rate of rat C6-glial cells by transfection with human 5-HT1D receptor genes. Biochem Biophys Res Commun. 1995 Sep 14;214(2):639-45. 7677777 Gerhard DS, Wagner L, Feingold EA, Shenmen CM, Grouse LH, Schuler G, Klein SL, Old S, Rasooly R, Good P, Guyer M, Peck AM, Derge JG, Lipman D, Collins FS, Jang W, Sherry S, Feolo M, Misquitta L, Lee E, Rotmistrovsky K, Greenhut SF, Schaefer CF, Buetow K, Bonner TI, Haussler D, Kent J, Kiekhaus M, Furey T, Brent M, Prange C, Schreiber K, Shapiro N, Bhat NK, Hopkins RF, Hsie F, Driscoll T, Soares MB, Casavant TL, Scheetz TE, Brown-stein MJ, Usdin TB, Toshiyuki S, Carninci P, Piao Y, Dudekula DB, Ko MS, Kawakami K, Suzuki Y, Sugano S, Gruber CE, Smith MR, Simmons B, Moore T, Waterman R, Johnson SL, Ruan Y, Wei CL, Mathavan S, Gunaratne PH, Wu J, Garcia AM, Hulyk SW, Fuh E, Yuan Y, Sneed A, Kowis C, Hodgson A, Muzny DM, McPherson J, Gibbs RA, Fahey J, Helton E, Ketteman M, Madan A, Rodrigues S, Sanchez A, Whiting M, Madari A, Young AC, Wetherby KD, Granite SJ, Kwong PN, Brinkley CP, Pearson RL, Bouffard GG, Blakesly RW, Green ED, Dickson MC, Rodriguez AC, Grimwood J, Schmutz J, Myers RM, Butterfield YS, Griffith M, Griffith OL, Krzywinski MI, Liao N, Morin R, Palmquist D, Petrescu AS, Skalska U, Smailus DE, Stott JM, Schnerch A, Schein JE, Jones SJ, Holt RA, Baross A, Marra MA, Clifton S, Makowski KA, Bosak S, Malek J: The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC). Genome Res. 2004 Oct;14(10B):2121-7. 15489334