NameMetallothionein-3
Synonyms
  • GIF
  • GIFB
  • Growth inhibitory factor
  • Metallothionein-III
  • MT-3
  • MT-III
Gene NameMT3
OrganismHuman
Amino acid sequence
>lcl|BSEQ0017834|Metallothionein-3
MDPETCPCPSGGSCTCADSCKCEGCKCTSCKKSCCSCCPAECEKCAKDCVCKGGEAAEAE
AEKCSCCQ
Number of residues68
Molecular Weight6926.855
Theoretical pINot Available
GO Classification
Functions
  • protein kinase activator activity
  • cysteine-type endopeptidase inhibitor activity involved in apoptotic process
  • drug binding
  • zinc ion binding
  • copper ion binding
  • antioxidant activity
  • cadmium ion binding
Processes
  • ERK1 and ERK2 cascade
  • positive regulation of ERK1 and ERK2 cascade
  • positive regulation of necrotic cell death
  • cell proliferation
  • negative regulation of autophagy
  • cellular response to hypoxia
  • positive regulation of catalytic activity
  • positive regulation of cell death
  • protein stabilization
  • cellular response to drug
  • cadmium ion homeostasis
  • leptin-mediated signaling pathway
  • positive regulation of gene expression
  • cellular metal ion homeostasis
  • cellular response to oxidative stress
  • negative regulation of neuron apoptotic process
  • negative regulation of cysteine-type endopeptidase activity
  • positive regulation of protein phosphorylation
  • negative regulation of oxidoreductase activity
  • negative regulation of hydrogen peroxide catabolic process
  • positive regulation of transcription, DNA-templated
  • regulation of response to food
  • positive regulation of vascular endothelial growth factor receptor signaling pathway
  • negative regulation of necrotic cell death
  • negative regulation of apoptotic process
  • cellular response to cadmium ion
  • positive regulation of lysosomal membrane permeability
  • positive regulation of oxygen metabolic process
  • negative regulation of cysteine-type endopeptidase activity involved in apoptotic process
  • negative regulation of axon extension
  • negative regulation of transcription, DNA-templated
  • positive regulation of transcription from RNA polymerase II promoter in response to oxidative stress
  • response to hypoxia
  • cholesterol catabolic process
  • regulation of protein glycosylation
  • energy reserve metabolic process
  • cellular zinc ion homeostasis
  • negative regulation of cell growth
  • zinc II ion transport
  • activation of protein kinase B activity
  • zinc ion homeostasis
  • protein kinase B signaling
  • astrocyte development
  • protein import into nucleus, translocation
  • histone modification
  • cellular lipid catabolic process
  • removal of superoxide radicals
  • cellular response to nitric oxide
  • brain development
  • negative regulation of reactive oxygen species metabolic process
Components
  • synaptic vesicle
  • inclusion body
  • mitochondrial outer membrane
  • astrocyte end-foot
  • perinuclear region of cytoplasm
  • dendritic spine
  • intracellular
  • cytoplasm
  • axon
  • rough endoplasmic reticulum
  • ribosome
  • postsynaptic density
  • microtubule
  • plasma membrane
  • extracellular space
General FunctionZinc ion binding
Specific FunctionBinds heavy metals. Contains three zinc and three copper atoms per polypeptide chain and only a negligible amount of cadmium. Inhibits survival and neurite formation of cortical neurons in vitro.
Pfam Domain Function
Transmembrane RegionsNot Available
GenBank Protein IDNot Available
UniProtKB IDP25713
UniProtKB Entry NameMT3_HUMAN
Cellular LocationNot Available
Gene sequence
>lcl|BSEQ0017835|Metallothionein-3 (MT3)
ATGGACCCTGAGACCTGCCCCTGCCCTTCTGGTGGCTCCTGCACCTGCGCGGACTCCTGC
AAGTGCGAGGGATGCAAATGCACCTCCTGCAAGAAGAGCTGCTGCTCCTGCTGCCCTGCG
GAGTGTGAGAAGTGTGCCAAGGACTGTGTGTGCAAAGGCGGAGAGGCAGCTGAGGCAGAA
GCAGAGAAGTGCAGCTGCTGCCAGTGA
GenBank Gene IDNot Available
GeneCard IDNot Available
GenAtlas IDNot Available
HGNC IDHGNC:7408
Chromosome Location16
LocusNot Available
References
  1. Uchida Y, Takio K, Titani K, Ihara Y, Tomonaga M: The growth inhibitory factor that is deficient in the Alzheimer's disease brain is a 68 amino acid metallothionein-like protein. Neuron. 1991 Aug;7(2):337-47. 1873033
  2. Palmiter RD, Findley SD, Whitmore TE, Durnam DM: MT-III, a brain-specific member of the metallothionein gene family. Proc Natl Acad Sci U S A. 1992 Jul 15;89(14):6333-7. 1631128
  3. Tsuji S, Kobayashi H, Uchida Y, Ihara Y, Miyatake T: Molecular cloning of human growth inhibitory factor cDNA and its down-regulation in Alzheimer's disease. EMBO J. 1992 Dec;11(13):4843-50. 1464312
  4. Naruse S, Igarashi S, Furuya T, Kobayashi H, Miyatake T, Tsuji S: Structures of the human and mouse growth inhibitory factor-encoding genes. Gene. 1994 Jul 8;144(2):283-7. 8039715
  5. Amoureux MC, Wurch T, Pauwels PJ: Modulation of metallothionein-III mRNA content and growth rate of rat C6-glial cells by transfection with human 5-HT1D receptor genes. Biochem Biophys Res Commun. 1995 Sep 14;214(2):639-45. 7677777
  6. Gerhard DS, Wagner L, Feingold EA, Shenmen CM, Grouse LH, Schuler G, Klein SL, Old S, Rasooly R, Good P, Guyer M, Peck AM, Derge JG, Lipman D, Collins FS, Jang W, Sherry S, Feolo M, Misquitta L, Lee E, Rotmistrovsky K, Greenhut SF, Schaefer CF, Buetow K, Bonner TI, Haussler D, Kent J, Kiekhaus M, Furey T, Brent M, Prange C, Schreiber K, Shapiro N, Bhat NK, Hopkins RF, Hsie F, Driscoll T, Soares MB, Casavant TL, Scheetz TE, Brown-stein MJ, Usdin TB, Toshiyuki S, Carninci P, Piao Y, Dudekula DB, Ko MS, Kawakami K, Suzuki Y, Sugano S, Gruber CE, Smith MR, Simmons B, Moore T, Waterman R, Johnson SL, Ruan Y, Wei CL, Mathavan S, Gunaratne PH, Wu J, Garcia AM, Hulyk SW, Fuh E, Yuan Y, Sneed A, Kowis C, Hodgson A, Muzny DM, McPherson J, Gibbs RA, Fahey J, Helton E, Ketteman M, Madan A, Rodrigues S, Sanchez A, Whiting M, Madari A, Young AC, Wetherby KD, Granite SJ, Kwong PN, Brinkley CP, Pearson RL, Bouffard GG, Blakesly RW, Green ED, Dickson MC, Rodriguez AC, Grimwood J, Schmutz J, Myers RM, Butterfield YS, Griffith M, Griffith OL, Krzywinski MI, Liao N, Morin R, Palmquist D, Petrescu AS, Skalska U, Smailus DE, Stott JM, Schnerch A, Schein JE, Jones SJ, Holt RA, Baross A, Marra MA, Clifton S, Makowski KA, Bosak S, Malek J: The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC). Genome Res. 2004 Oct;14(10B):2121-7. 15489334